active questions tagged python+string - Stack Overflow

Remove whitespace in Python using string.whitespace

2009-12-14T02:30:34Z

Python's string.whitespace is great:

>>> string.whitespace
'\t\n\x0b\x0c\r '

How do I use this with a string without resorting to manually typing in '\t|\n|... etc for regex?

For example, it should be able to turn: "Please \n don't \t hurt \x0b me."

into

"Please don't hurt me."

I'd probably want to keep the single spaces, but it'd be easy enough to just go string.whitespace[:-1] I suppose.

Standard way to embed version into python package?

2009-01-19T18:05:54Z

Hey everyone,

Is there a standard way to associate version string with a python package in such way that I could do the following?

import foo
print foo.version

I would imagine there's some way to retrieve that data without any extra hardcoding, since minor/major strings are specified in setup.py already. Alternative solution that I found was to have import __version__ in my foo/__init__.py and then have __version__.py generated by setup.py

Thanks,

How to override ord behaivour in Python for str childs?

2009-12-12T15:52:03Z

I have this class:

class STR(str):

    def __int__(self):
        return 42

If i use it in the promt like this:

>>> a=STR('8')
>>> ord(a)
56
>>> int(a)
42
>>> chr(a)
'*'

that's the behaivour. I'd like to ord(a) be 42. How can I do it? Which method should I override in the str class? Is all this documented anywhere?

Thanks!

Find the nth occurrence of substring in a string

2009-12-10T20:58:50Z

This seems like it should be pretty trivial, but I am new at Python and want to do it the most Pythonic way.

I want to find the n'th occurrence of a substring in a string.

There's got to be something equivalent to what I WANT to do which is

mystring.find("substring", 2nd)

How can you achieve this in Python?

How to do a string replace in a urlencoded string

2009-12-11T08:42:10Z

I have a string like x = "http://query.yahooapis.com/v1/public/yql?q=select%20owner%2Curls%20from%20flickr.photos.info%20where%20photo_id%3D'%s'&format=json"

If I do x % 10 that fails as there are %20f etc which are being treated as format strings, so I have to do a string conactination. How can I use normal string replacements here.?

How do I un-escape a backslash-escaped string in python?

2009-12-11T01:00:01Z

Suppose I have a string which is a backslash-escaped version of another string. Is there an easy way, in Python, to unescape the string? I could, for example, do:

>>> escaped_str = '"Hello,\\nworld!"'
>>> raw_str = eval(escaped_str)
>>> print raw_str
Hello,
world!
>>>

However that involves passing a (possibly untrusted) string to eval() which is a security risk. Is there a function in the standard lib which takes a string and produces a string with no security implications?

Explain Python .join()

2009-12-09T19:22:04Z

I'm pretty new to Python and am completely confused by .join() which I have read is the preferred method for concatenating strings.

I try:

strid = repr(595)
print array.array('c', random.sample(string.ascii_letters, 20 - len(strid)))
    .tostring().join(strid)

and get something like:

5wlfgALGbXOahekxSs9wlfgALGbXOahekxSs5

Why does it work like this? Shouldn't the '595' just be automatically appended?

PEP8 - 80 Characters - Big Strings

2009-12-09T15:20:54Z

Due to the sheer annoyance of figuring out what to Google, I've decided to risk what any reputation I had to ask this rather simple question.

As PEP8 suggests keeping below the 80 column rule for your python program, how can I abide to that with long strings, i.e.

s = "this is my really, really, really, really, really, really, really long string that I'd like to shorten."

How would I go about expanding this to the following line, i.e.

s = "this is my really, really, really, really, really, really" + 
    "really long string that I'd like to shorten."

Data extraction and manipulation in jython

2009-12-09T15:35:48Z

For a given file

For ex : 11 ,345 , sdfsfsfs , 1232

i need to such above records from a file , read 11 to delimiter and strip the white space and store in the another file , similarly 345 to delimiter strip the while space and store in the file. This way i need to do for multiple rows.

so finally in the other file the data should look like

11,345,sdfsfsfs,1232

Please suggest me the way. Thanks for your help.

String Conversion

2009-12-09T12:44:18Z

Hi i have string

s='This is sample'

i need to convert like this

s='"This is sample"'

output="This is sample"

how to do this in dynamic
Thanks in advance

Convert and merge strings into a list in Python

2009-12-08T18:17:58Z

In Python I have four strings that include the formatting of a list:

line1 ="['a.b.c','b.c.a','c.d.e']"
line2 ="['def','efg']"
line3 ="['f']"
line4 ="['g']"

How do I merge them all so I get a valid Python list such as:

SumLine = ['a.b.c','b.c.a','c.d.e','def','efg','f','g']

Search a file for a string, and execute a function if string not found; in python

2009-12-08T08:23:35Z

def checkCache(cachedText):
    for line in open("cache"):
        if cachedText + ":" in line:
            print line
            open("cache").close()
        else:
            requestDefinition(cachedText)

This code searches each line of a file (cache) for a specific string (cachedText + ":").

If it does not find the specific string, within the entire file it is meant to call another function (requestNewDefinition(cachedText)).

However my above code executes the function for each non-matching line.

How can one search a file for a string (cachedText + ":"), and if the string is not found anywhere in the file, execute another function?

Example Cache:

hello:world
foo:bar

Strip final 0 off a python string

2009-12-08T04:34:32Z

#!/usr/bin/env python
import os, sys, subprocess, time
while True:    
    print subprocess.call("xsel", shell=True);
    time.sleep(1);

Takes an entry from the clipboard and prints it, every 1 second.

Result:

copied0
entry0
from0
clipboard0

I do not know why it returns the final 0, but it apparently stops me from using string strip (int has not strip), hence the 0 makes the string an integer?

How can one strip final 0 off the python string in the result above?

I'm a BASH scripter converting to python.

Replace Multiple lines in Jython

2009-12-05T23:50:17Z

Hi Everyone ,

I have written a small program to replace a set of characters , but i also want two or more replace command in a single program .

Apart from it i also want to add an bracket after random set of characters.

This is my Program

file_read=open('<%=odiRef.getOption("READ")%>/EXPORT.XML','r')
file_write=open('<%=odiRef.getOption("READ")%>/EXPORT_1.XML','w')
count_record=file_read.read()
while count_record :
    s=count_record.replace('<Field name="ExeDb"type="java.lang.String"><![CDATA[S]]></Field>','<Field name="ExeDb" type="java.lang.String"><![CDATA[W]]></Field>')
    file_write.write(s)
    t=count_record.replace('<Field name="Txt" type="java.lang.String"><![CDATA[','<Field name="Txt" type="java.lang.String"><![CDATA[TRIM(')
    file_write.write(t)
    count_record=file_read.read()
    print s
file_read.close()
file_write.close()

As you can see when i try to do with read line i get two lines in the final file.

1) I want both the replace command to work but with only single file.

2) Also is there is any way to read and write in a single file , i dont know why r+ was not working properly.

3) I also want to modify the line

t=count_record.replace('<Field name="Txt" type="java.lang.String"><![CDATA[','<Field name="Txt" type="java.lang.String"><![CDATA[TRIM(')

to somethings like

t=count_record.replace('<Field name="Txt" type="java.lang.String"><![CDATA[','<Field name="Txt" type="java.lang.String"><![CDATA[TRIM($$$) ')

where $$$ represents words or character present in the source File.

in short adding ) close bracket at the end , irrespective of any number of words or character after opening bracket .

Thanks so much for all your help.

What is internal representation of string in Python 3.x

2009-12-03T06:57:36Z

In Python 3.x, a string consists of items of Unicode ordinal. (See the quotation from the language reference below.) What is the internal representation of Unicode string? Is it UTF-16?

The items of a string object are Unicode code units. A Unicode code unit is represented by a string object of one item and can hold either a 16-bit or 32-bit value representing a Unicode ordinal (the maximum value for the ordinal is given in sys.maxunicode, and depends on how Python is configured at compile time). Surrogate pairs may be present in the Unicode object, and will be reported as two separate items.

Simple way to convert a string to a dictionary

2009-11-29T02:03:17Z

What is the simplest way to convert a string of keyword=values to a dictionary, for example the following string:

name="John Smith", age=34, height=173.2, location="US", avatar=":,=)"

to the following python dictionary:

{'name':'John Smith', 'age':34, 'height':173.2, 'location':'US', 'avatar':':,=)'}

The 'avatar' key is just to show that the strings can contain = and , so a simple 'split' won't do. Any ideas? Thanks!

Python: How to get StringIO.writelines to accept unicode string?

2009-11-30T03:23:28Z

I'm getting a

UnicodeEncodeError: 'ascii' codec can't encode character u'\xa3' in position 34: ordinal not in range(128)

on a string stored in 'a.desc' below as it contains the '£' character. It's stored in the underlying Google App Engine datastore as a unicode string so that's fine. The cStringIO.StringIO.writelines function is trying seemingly trying to encode it in ascii format:

result.writelines(['blahblah',a.desc,'blahblahblah'])

How do I instruct it to treat the encoding as unicode if that's the correct phrasing?

app engine runs on python 2.5

I am trying to determine if a string is a Question. How can I analyze the "?" symbol (python)

2009-11-24T09:44:19Z

This is a question:

"Where is the car?"

This is NOT a question:

"Check this out: http://domain.com/?q=test"

How do I write a function to analyze a string so that we know for sure it is a question and not part of a URL?

Python equivalent of ruby's StringScanner?

2009-11-17T21:31:08Z

Is there a python class equivalent to ruby's StringScanner class? I Could hack something together, but i don't want to reinvent the wheel if this already exists.

Remove one char from a string

2009-11-17T14:31:06Z

Hi Alls,

I'd like to remove one char from a string like this:

string = "ASDFVGHFJHRSFDZFDJKUYTRDSEADFDHDS"

print len(string)

(33)

So i would like to remove one random char in this string, and then have a len = 32 What's the best way to do so ?

EDIT: thanks for your answers, but i forgot something: i'd like to print the char removed; Using Anurag Uniyal technique ?

Thanks !

Python: How to ignore #comment lines when reading in a file.

2009-11-10T07:36:44Z

In Python, I have just read a line form a text file and I'd like to know how to code to ignore comments with a hash # at the beginning of the line.

I think it should be something like this:

for 
   if line !contain #
      then ...process line
   else end for loop

But I'm new to Python and I don't know the syntax

Convert float to string with cutting zero decimals afer point in Python

2009-11-16T15:35:45Z

Hi all!

I am feeling difficult to convert a float to string in the following manner:

20.02  --> 20.02
20.016 --> 20.02
20.0   --> 20

Seems "%g" format is the best for that, but I am getting strange results:

In [30]: "%.2g" % 20.03
Out[30]: '20'

In [31]: "%.2g" % 20.1
Out[31]: '20'

In [32]: "%.2g" % 20.3
Out[32]: '20'

In [33]: "%.2g" % 1.2
Out[33]: '1.2'

In [34]: "%.2g" % 1.0
Out[34]: '1'

In [35]: "%.2g" % 2.0
Out[35]: '2'

In [36]: "%.2g" % 2.2
Out[36]: '2.2'

In [37]: "%.2g" % 2.25
Out[37]: '2.2'

In [38]: "%.2g" % 2.26
Out[38]: '2.3'

In [39]: "%.3g" % 2.26
Out[39]: '2.26'

In [40]: "%.3g" % 2.25
Out[40]: '2.25'

In [41]: "%.3g" % 20.02
Out[41]: '20'

In [42]: "%.3g" % 20.016
Out[42]: '20'

In [43]: "%.20g" % 20.016
Out[43]: '20.015999999999998238'

The only way I know at the time is checking whether the number is int and apply "%d" instead of "%f" formatting - this is too complicated, I think. Does anyboidy know why the things above are hapenning? How to do this simpler?

Thanks.

What is the max length of a python string?

2009-11-16T03:37:28Z

If it is environment-independent, what is the theoretical maximum number of characters in a python string?

Also if it differs with version number I'd like to know it for python 2.5.2

Count the number of occurences of letters in a Python string

2009-11-15T18:58:15Z

So I got a DNA sequence.

ACCAGAGCGGCACAGCAGCGACATCAGCACTAGCACTAGCATCAGCATCAGCATCAGC
CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT
ACACCCCCCCCGGTGTGTGTGGGGGGTTAAAAATGATGAGTGATGAGTGAGTTGTGTG
CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT
TTCTATCATCATTCGGCGGGGGGATATATTATAGCGCGCGATTATTGCGCAGTCTACG
TCATCGACTACGATCAGCATCAGCATCAGCATCAGCATCGACTAGCATCAGCTACGAC

I need to count the bases.

Also for some reason it can sometimes it can alternate between upper or lowercase in the same string.

Classify array of strings based on commonalities

2009-11-12T04:22:55Z

I have huge list (200000) of strings (multi word). I want to group these strings based on comman array of word match among these strings. I cant think of a low computation time algorithm for this

"AB 500"
"Bus AB 500"
"News CA"
"News CA BLAH"

My plan was
a. Tokenize them to words.
b. Create a global array tokens
c. Compare those strings with common tokens.

As you guessed this does not help. Can you suggest an algorithm for this? I am writing this in python..

how to split a string to what I want in python

2009-11-11T08:46:46Z

I have string ling like this:

'Toy Stroy..(II) (1995)'

I want to split the line to two parts like this:

['Toy Story..(II)','1995']

How can I do it? thanks

What does 'u' mean in a list?

2009-11-10T16:11:41Z

This is the first time I've came across this. Just printed a list and each element seems to have a u in front of it i.e.

[u'hello', u'hi', u'hey']

What does it mean and why would a list have this in front of each element?

As I don't know how common this is, if you'd like to see how I came across it, I'll happily edit the post.

How to create an image from a string in python

2009-11-03T02:20:39Z

Hi,

I'm currently having trouble creating an image from a binary string of data in my Python program. I receive the binary data via a socket but when I try the methods I read about on here like this:

buff = StringIO.StringIO() #buffer where image is stored
#Then I concatenate data by doing a 
buff.write(data) #the data from the socket
im = Image.open(buff)

I get an exception to the effect of "image type not recognized". I know that I am receiving the data correctly because if I write the image to a file and then open a file it works:

buff = StringIO.StringIO()#buffer where image is stored
buff.write(data) #data is from the socket
output = open("tmp.jpg", 'wb')
output.write(buff)
output.close()
im = Image.open("tmp.jpg")
im.show()

I figure I am probably doing something wrong in using the StringIO class but I'm not sure. Thanks for the help in advance!

insert string in the middle of a file given a file object

2009-10-29T17:40:09Z

I am working on a problem and got stuck at a wall

I have a (potentially large) set of text files, and I need to apply a sequence of filters and transformations to it and export it to some other places.

so I roughly have

def apply_filter_transformer(basepath = None, newpath = None, fts= None):
    #because all the raw studies in basepath should not be modified, so I first cp all to newpath
    for i in listdir(basepath):
        file(path.join(newpath, i), "wb").writelines(file(path.join(basepath, i)).readlines())
    for i in listdir(newpath):
        fileobj = open(path.join(newpath, i), "r+")
        for fcn in fts:
            fileobj = fcn(fileobj)
        if fileobj is not None:
            fileobj.writelines(fileobj.readlines())
        try:
            fileobj.close()
        except:
            print i, "at", fcn
            pass
def main():
    apply_filter_transformer(path.join(pardir, pardir, "studies"),
                         path.abspath(path.join(pardir, pardir, "filtered_studies")),
                         [
                        #transformer_addMemo,
                          filter_executable,
                          transformer_identity,
                          filter_identity,
                          ])

and fts in apply_filter_transformer is a list of function that takes a python file object and return a python file object. The problem that I went into is that when I want to insert strings into a text object, I get uninformative error and got stuck for all morning.

def transformer_addMemo(fileobj):
    STYLUSMEMO =r"""hellow world"""
    study = fileobj.read()
    location = re.search(r"</BasicOptions>", study)
    print fileobj.name
    print fileobj.mode
    fileobj.seek(0)
    fileobj.write(study[:location.end()] + STYLUSMEMO + study[location.end():])
    return fileobj

and this gives me

Traceback (most recent call last):
 File "E:\mypy\reg_test\src\preprocessor\preprocessor.py", line 292, in <module>
  main()
 File "E:\mypy\reg_test\src\preprocessor\preprocessor.py", line 288, in main
 filter_identity,
 File "E:\mypy\reg_test\src\preprocessor\preprocessor.py", line 276, in     apply_filter_transformer
   fileobj.writelines(fileobj.readlines())
   IOError: [Errno 0] Error

If anyone can give me more info on the error, I would appreciate very very much.

Python format timedelta to string

2009-02-11T20:40:43Z

Hi, I'm a python newbie (2 weeks) and I'm having trouble formatting a datetime.timedelta object.

Here's what I'm trying to do. I have a list of objects and one of the members of the class of the object is a timedelta object that shows the duration of an event. I would like to display that duration in the format of hours:minutes.

I have tried a variety of methods for doing this and I'm having difficulty. My current approach is to add methods to the class for my objects that return hours and minutes. I can get the hours by dividing the timedelta.seconds by 3600 and rounding it. I'm having trouble with getting the remainder seconds and converting that to minutes.

By the way, I'm using Google AppEngine with DJango Templates for presentation.

If anyone can help or knows of a better way to resolve this, I would be very happy.

Thanks,