Tell me more ×
Stack Overflow is a question and answer site for professional and enthusiast programmers. It's 100% free, no registration required.

I have a couple of files which have a format of something like this:

TCTCTGGAAAGGGACGCCTGGGAGG   10
AAAAATACATTCTAACCTCGGCGT    1
TAATTTCATCAATATATCAATG  1
(etc...)

I want to remove everything after the space so that I only get this in the end:

TCTCTGGAAAGGGACGCCTGGGAGG
AAAAATACATTCTAACCTCGGCGT
TAATTTCATCAATATATCAATG
(etc...)

How would I do this?

share|improve this question
1  
Should we assume that you have standard Unix tools such as sed, awk, perl, etc? And when you say that you want to remove everything "after" the space, do you mean "after and including"? – Mark Byers Jun 24 '12 at 19:20
Yes everything after and including the space. Also I have all standard Unix tools. – Bucco Jun 30 '12 at 2:33

3 Answers

You can do this with awk:

cat oldfile | awk '{print $1}' > newfile
share|improve this answer
So all of these methods will return the new file with the spaces and the numbers removed right? – Bucco Jun 30 '12 at 2:32
yes, newfile will contain only the strings from the beginning of the line – timos Jun 30 '12 at 4:00
cut -d' ' -f1 file.txt

or:

sed 's/ .*//' file.txt

or

sed -e 's/[^ACTG]//g' file.txt

or

awk '{print $1}' file.txt
share|improve this answer
So all of these methods will return the new file with the spaces and the numbers removed right? – Bucco Jun 30 '12 at 2:32

Not as concise and pretty as timos's answer :), but another quick example of the same functionality but written in Ruby.

#!/usr/bin/env ruby

data = File.read("data.txt")
f = File.open("outData.txt", "w")
finalData = data.scan(/^\w+/)
finalData.each {|i| f.write(i + "\n")}
f.close
share|improve this answer
So all of these methods will return the new file with the spaces and the numbers removed right? – Bucco Jun 30 '12 at 2:32
Hi Bucco, yes the following code will do as you require in your question. If you have a file containing lots of lines of something like "TCTCTGGAAAGGGACGCCTGGGAGG 10" it will parse them to a file called outData.txt and will contain only the DNA data – David K Jul 4 '12 at 12:33

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.