Tell me more ×
Stack Overflow is a question and answer site for professional and enthusiast programmers. It's 100% free, no registration required.

I want a regular expression that would check if a string contains any character apart from "A" , "G", "C" , "U" e the string would be like ggggugcccgcuagagagacagu

i want regex to check if it containns only these , it is not case sensitive.

what i tried

match= re.match(r'[^GaAgUuCc]',seq2)

It is to find non RNA characters in a RNA sequence

share|improve this question

3 Answers

up vote 1 down vote accepted

You should use re.search() or re.findall() rather than re.match():

In [9]: seq2 = 'ggggugcccQgcuagagaZgacagu'

In [10]: re.findall(r'[^GaAgUuCc]',seq2)
Out[10]: ['Q', 'Z']
share|improve this answer
   
I selected your solution as the answer because the search and findall functions did the trick .. thank you – n jack Nov 30 '12 at 20:12

Use re.search instead:

>>> re.search(r'[^GAUC]', 'acg', re.I)
>>> re.search(r'[^GAUC]', 'acgf', re.I)
<_sre.SRE_Match object at 0x7f1b6a9e32a0>

re.I makes the regex case-insensitive.

A faster way to do it would be to use sets to check if the set of characters is a subset of your allowed characters:

>>> set('acg'.upper()) <= set('GAUC')
True
>>> set('acgs'.upper()) <= set('GAUC')
False
share|improve this answer
Could create the set once - valid = set('gauc') and do valid.issuperset(the_string) – Jon Clements Nov 30 '12 at 20:06

You need to use a quantifier with your regex to match more characters: -

>>> match = re.search("[^GAUC]+","ggggugcccgcuagrrragagacagu", re.I)
>>> match
9: <_sre.SRE_Match object at 0x01BCA8A8>
>>> match.group()
10: 'rrr'
share|improve this answer
i dont wish to negate any case characters , it should not be case sensitive . – n jack Nov 30 '12 at 19:58
@njack.. Updated Regex.You can use re.I to do case-insensitive searching. Also, you should use re.search instead, if you want to search non-matching characters. – Rohit Jain Nov 30 '12 at 20:00

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.