Tell me more ×
Stack Overflow is a question and answer site for professional and enthusiast programmers. It's 100% free, no registration required.

I've got code so far that seems to change letters. However, this is how it should be changed: All G become C. All C become G. All T become A. And all A become T.

This is where my problem is happening. As seen, for example, since T becomes A and A becomes T, the code is just leaving it as a T. Because it's changing it to A and then just changing that same character back to T. I need to make it so it makes all the changes at the same time so it doesn't overlap like that. Same thing with G to C and C to G.

This is a sample of what's inside the text file: GTCGACTGCACTCGCCCCCACGAGAGAACAGTATTTAAGGAGCTGCGAAGGTCCAAGTCATGCATTATTG TCTCAGTGCAGTTGTCAGTTGCAGTTCAGCAGACGGGCTAACGAGTACTTGCATCTCTTCAAATTTACTT AATTGATCAAGTAAGTAGCAAAAGGGCACACAATTGAAGGAAATTCTTGTTTAATTGAATTTATTATGCA

Basically just massive string like that. I need to reverse all letters as outlined above. Likewise, I am trying to count the number of times the following string occurs: "GCAA" before changing the characters.

This is my code so far:

f = open("filename.txt", "r")
from string import maketrans
table = maketrans("G", "C")
table = maketrans("C", "G")
table = maketrans("T", "A")
table = maketrans("A", "t")
print(f.read().translate(maketrans('G','C')))
print(f.read().translate(maketrans('C','G')))
print(f.read().translate(maketrans('T','A')))
print(f.read().translate(maketrans('A','T')))

print(table)

I don't know how I would go about counting anything though, so I haven't gotten to that part yet.

share|improve this question

1 Answer

up vote 0 down vote accepted

Use a single call to maketrans like this:

from string import maketrans
table = maketrans("GCTA", "CGAT")
f = open("filename.txt", "r")
input = f.read()
print(input.translate(table))
print(input.count('GCAA'))
share|improve this answer
Oh, great. It works! So basically doing a single line maketrans like this bypasses the issue I was having. Now it does change A to T and T to A without any overlaps, etc. What about counting an occurrence of a particular string/sequence of characters such as "GCAA"? I tried looking up some doc and see that str.count(" ") might be of some use, but I can't get it to work. For instance, counting GCAA BEFORE switching the letters. And also, counting GCAA AFTER the letters are switched with the maketrans. – user1985793 Feb 13 at 23:37
1) Yes it does. 2) see the last line :-) – Dangelov Feb 13 at 23:42
Sorry, just updated again lol – user1985793 Feb 13 at 23:42
So, this seems to be counting GCAA after the switch of the letters is made. What if I wanted to count also before the switching? I can just create another variable before the maketrans line and then output that at the end? – user1985793 Feb 13 at 23:44
g = open("filename.txt", "r") input2 = g.read() print(input2.count('GCAA')) Does adding these lines to the very beginning do it correctly? I'm not sure because I am getting the same number both times. I just took the translate out and made the read 'g' instead 'f' to have different variables – user1985793 Feb 13 at 23:49
show 11 more comments

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.