Tell me more ×
Stack Overflow is a question and answer site for professional and enthusiast programmers. It's 100% free, no registration required.

So I got a DNA sequence.

ACCAGAGCGGCACAGCAGCGACATCAGCACTAGCACTAGCATCAGCATCAGCATCAGC
CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT
ACACCCCCCCCGGTGTGTGTGGGGGGTTAAAAATGATGAGTGATGAGTGAGTTGTGTG
CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT
TTCTATCATCATTCGGCGGGGGGATATATTATAGCGCGCGATTATTGCGCAGTCTACG
TCATCGACTACGATCAGCATCAGCATCAGCATCAGCATCGACTAGCATCAGCTACGAC

I need to count the bases.

Also for some reason it can sometimes it can alternate between upper or lowercase in the same string.

share|improve this question
Please mark homework with the [homework] tag. – S.Lott Nov 16 '09 at 3:11
it wasn't hw BRO – WHO EVEN CARES Jun 17 '12 at 1:55
I think the question is perfectly fine. Even if it was homework, its an interesting problem. Why not ask it here ? +1 from me – lhk Dec 2 '12 at 12:07

1 Answer

up vote 7 down vote accepted
for base in 'ACGT':
  print base, thesequence.count(base) + thesequence.count(base.lower())
share|improve this answer
Thank you sire wholeheartedly. – WHO EVEN CARES Nov 15 '09 at 19:02
Out of curiosity, is there a reason you don't do thesequence.lower().count(base.lower()), instead? I'm guessing it's to make it faster, but I'm not 100% sure. – Edan Maor Nov 15 '09 at 19:03
It's not necessarily faster this way, but it takes less memory. Since DNA sequences can be long this can be important. – sth Nov 15 '09 at 19:26
Yep, as you need to do two passes anyway, it's better to have both be counting ones (memory-thrifty) rather than have one take up O(N) extra temporary memory. If you do have memory to spare, a single tmp = sequence.lower() outside the loop (then loop over 'acgt' in lowercase doing just tmp.count(base)) is going to be faster. A single pass with a finditer on a case-insensitive RE might be fastest, but a lot less simple than these approaches;-). – Alex Martelli Nov 15 '09 at 19:52

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.