Tell me more ×
Stack Overflow is a question and answer site for professional and enthusiast programmers. It's 100% free, no registration required.

Why am i getting an "invalid syntax" when i run below code. Python 2.7

from string import *

def countSubStringMatch(target,key):
    counter=0
    fsi=0 #fsi=find string index
    while fsi<len(target):
        fsi=dna.find(key,fsi)      
        if fsi!=-1:
           counter+=1
        else:
            counter=0
            fsi=fsi+1
        fsi=fsi+1
    #print '%s is %d times in the target string' %(key,counter)

def countSubStringMatch("atgacatgcacaagtatgcat","atgc")
share|improve this question
Please fix the code formatting, use the little 101/010 button – Nick T Aug 19 '10 at 20:36
2  
-1 I think the minimum standard for asking questions on SO should be that the asker understands the syntax of the language, e.g. use of the def keyword. – Jesse Dhillon Aug 20 '10 at 6:02

3 Answers

up vote 5 down vote accepted

In the line:

def countSubStringMatch("atgacatgcacaagtatgcat","atgc")

You should remove the def. def is used when defining a function, not when calling it.

share|improve this answer
apologies for asking such a simple question, beginner's mistake...thanks – raoulbia Aug 26 '10 at 23:13

for string count you could just do:

target = "atgacatgcacaagtatgcat"
s = 'atgc'
print '%s is %d times in the target string' % (s, target.count(s))
share|improve this answer

Other things wrong with your code:

  1. You don't use and don't need anything in the string module. Don't import from it.

  2. Don't do from somemodule import * unless you have a very good reason for it.

  3. Your code rather slowly and pointlessly struggles on after the first time that find returns -1 ... your loop should include

    if fsi == -1: return counter

    so that you return immediately with the correct count.

  4. Be consistent: you use counter += 1 but fsi = fsi + 1

  5. ... which reminds me: find 'PEP 8' (style guide) at www.python.org, and read it -- your space bar must be feeling unloved ;-)

HTH
John

share|improve this answer
Hi John, thanks for pointintg this out to me! – raoulbia Aug 21 '10 at 21:32
@Baba: (1) see my edit; in problem #3, should return counter, not 0 (2) problem #6: calculate len(dna) ONCE, before entering while loop – John Machin Aug 21 '10 at 21:55

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.