up vote 0 down vote favorite
share [g+] share [fb]

HELP? i need to map 20bp sequences produced by a gene expression analysis (fastq)to the contigs produced by a 454 assemblage (fasta), here is the kicker i dont care about the tags mapped to the open reading frame (ORF) range of the contigs. i have a file with the ORF ranges for each contig in the assemblage i just can’t combine all 3 ideas, im a noob so sorry if this is super cakie i have an idea but am a poor programmer, match the names of the contigs in the assemblage file and the ORF finder file then delete all the sequence in the ORF range. taking this new ORF free assemblage and mapping the short tags to it, only allowing for one (20bp) tag to contig(ORF free) match .

so i want to locate the 20bp tags in the 454 assembalage out side of the ORF range.

example data in files. (files up to 2GB)

20bp tags

GATCCAGGATGGAGTCTTTG

GATCCTGAAGATGGAGTCTC

GATCCTTCCACACAAAGTGG

GATCACTGGACCGGCGGCCA

GATCTTTAGTCTAAAGTGTC

the 454 assemblage

GD4HFQN03F001A tcagacgagtgcgtGCGCACCGGACCAGAAAGGCCAGGCTGGGCCTGAGCAAGGGGAGGCAGTGGGTACGACCACGGCCagcggcgcggccaattccgggaccgagccaaggcagcggcgggaggcggctttggtcacgggacgtcttcctgcggaggtgggcccgtcgacagtcatggaaatgacctcttccccaccggaggaggacgagaccgacgggtggcggcggat

GD4HFQN03F00HK tcagacgagtgcgtCCATTACGGCCGAAAACCTCACCTTACCTCAACATAAAACAATACAACACAGCAACACTCAAACCCCACACCCTCTCAATAACCAACAACAAATCTTGAAAAACATGTCTTCCGGCCTCACCAACGAAAAGGGCCAAGGCGCCTCGCACGCAACCCAGTCCTCCGTCCCCGGCAAAGTCCAGGACAAGGCCCCCAAGTCC

GD4HFQN03F00IW tcagacgagtgcgtGCTCTCGCCGGATCTAGATTGGTGGTTCCATGGTCCGCCGTCACACCAGTTCTTGATGCGATTGCTCACCGGTGTTTCATCACCAGACGACGTCGATTTCCAATTTCAGCCCCAATCCTTCGCCTCATTCGGACCCACCGTCCTTGTCGAAGGCTGCGATTCCGATCTGTCCATAGCTTGGGTTCACGCCTGGACCGTGACGGATGGGATAATTACCCAGGTTAGGGAGTACTTCAACACTTCCCTCACCGTCACCCGCCTCGGCCCGTTACGTAGCGTATCGTTGacctgagactgccaaggcacacaggggataggn

the ORF ranges

GD4HFQN03F001A 176,445

GD4HFQN03F00HK 119,409

GD4HFQN03F00IW 70,303

link|improve this question
So hard to read your question. :( Nearly impossible to understand what you are asking. – ulidtko Feb 5 '11 at 1:25
Nico, you probably need to look for a specialist bioinformatic forum for this sort of question - stackoverflow does better with general programming help. Try the biopython mailing list: lists.open-bio.org/mailman/listinfo/biopython – Thomas K Feb 5 '11 at 2:09
FWIW, as far as I can understand what you're after, it should be perfectly doable. I'm a biologist, but I don't do bioinformatics stuff, so I can't give you step by step instructions. – Thomas K Feb 5 '11 at 2:11
This would be easier with some concrete examples. What does a '20bp sequence' look like? What does a 'contig produced by a 454 assemblage' look like? What is an ORF range? Can you give one end-to-end example - what comes in, what constitutes a match, what the final result should look like? – Hugh Bothwell Feb 5 '11 at 4:16
ok sorry guys I have made some edits to try too help clear things up – nico Feb 8 '11 at 4:54
show 1 more comment
feedback

Know someone who can answer? Share a link to this question via email, Google+, Twitter, or Facebook.

Your Answer

 
or
required, but never shown
discard

Browse other questions tagged or ask your own question.