CSS: how can I force a long string (without any blank) to be wrapped in XUL and/or HTML

Question

I have a long string (a DNA sequence). It does not contain any whitespace character. e.g.:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA

what would be the css selector to force this text to be wrapped in an html:textarea or in a xul:textbox

Answer 1

<textarea style="border:1px solid red; width:100px;word-wrap:break-word;">AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA</textarea>

Answer 2

Place zero-width spaces at the points where you want to allow breaks. The zero-width space is ​ in HTML. For example:

ACTGATCG​AGCTGAAG​CGCAGTGC​GATGCTTC​GATGATGC

Answer 3

For me this works,

<td width="170px" style="word-wrap:break-word;">
  <div style="width:140px;overflow:auto">
    LONGTEXTGOESHERELONGDIVGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESHERELONGDIVLONGTEXTLONGTEXT
  </div>
</td>

You can also use a div inside another div instead of td. I used overflow:auto, as it shows all the text both in my Opera and IE browsers.

Answer 4

I don't think you can do this with CSS. Instead, at regular 'word lengths' along the string, insert an HTML soft-hyphen:

ACTGATCG­AGCTGAAG­CGCAGTGC­GATGCTTC­GATGATGC­TGACGATG

This will display a hyphen at the end of the line, where it wraps, which may or may not be what you want.

Note Safari seems to wrap the long string in a <textarea> anyway, unlike Firefox.

Answer 5

If you're using PHP then the wordwrap function works well for this: http://php.net/manual/en/function.wordwrap.php

The CSS solution word-wrap: break-word; does not seem to be consistent across all browsers.

Other server-side languages have similar functions - or can be hand built.

Here's how the the PHP wordwrap function works:

$string = "ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA";

$wrappedstring = wordwrap($string,50,"<br>",true);

This wraps the string at 50 characters with a <br> tag. The 'true' parameter forces the string to be cut.

Answer 6

For word-wrap:break-word; to work for me, I had to make sure the display was set to block, and that the width was set on the element. In Safari, it had to have a p tag and the width had to be set in ex.

Answer 7

Use a CSS method to force wrap a string that has no white-spaces. Three methods:

1) Use the CSS white-space property. To cover browser inconsistencies, you have to declare it several ways. So just put your looooong string into some block level element (e.g., div, pre, p) and give that element the following css:

some_block_level_tag {
    white-space: pre;           /* CSS 2.0 */
    white-space: pre-wrap;      /* CSS 2.1 */
    white-space: pre-line;      /* CSS 3.0 */
    white-space: -pre-wrap;     /* Opera 4-6 */
    white-space: -o-pre-wrap;   /* Opera 7 */
    white-space: -moz-pre-wrap; /* Mozilla */
    white-space: -hp-pre-wrap;  /* HP Printers */
    word-wrap: break-word;      /* IE 5+ */
}

2) use the force-wrap mixin from Compass.

3) I was just looking into this as well and I think might also work (but I need to test browser support more completely):

.break-me {
    word-wrap: break-word;
    overflow-wrap: break-word;
}

Reference: wrapping content

Answer 8

Looking at how stackoverflow does it, I would use the following css.

.post-text p {
  word-wrap: break-word;
}