Tell me more ×
Stack Overflow is a question and answer site for professional and enthusiast programmers. It's 100% free, no registration required.

I am looking for an efficient solution to do find the longest possible substring in a string tolerating n mismatches in the main string

Eg: Main String

  1. AGACGTACTACTCTACTAGATGCA*TACTCTAC*
  2. AGACGTACTACTCTACTAGATGCA*TACTCTAC*
  3. AGACGTACTACTCTACAAGATGCA*TACTCTAC*
  4. AGACGTACTACTTTACAAGATGCA*TACTCTAC*

Search String:

  1. TACTCTACT : this should be considered a match to all of the above main strings.

Also I there could be the case where part of the substring is at the end of main string and I would like to pick that up also.

I would appreciate if you could give some pointers.

PS: I will have one search string and about 100 million main strings to search the substring for.

Thanks! -Abhi

share|improve this question
Questions. 1) Your numbers in "Main String" - are those separate lines in one "Main String", or four separate "Main String"s (I assume the latter, but want to confirm)? 2) Can you explain why that search string would be considered a match for #3 and #4? The first two clearly match, but it's not clear to me why the last two do, and that sounds like it may be a crucial detail to understand. 3) Can you explain what you mean that part of the substring may be at the end of the main string? – Brian Gerard Jun 6 '11 at 23:27
You mention "longest", but your example doesn't provide any clue as to what you mean by longest. Do you mean with the fewest mismatch? – ikegami Jun 6 '11 at 23:48
1  
@Brian Gerard: 1) Those are 4 of the million main strings. 2) Because he tolerates mismatches. #3: A for T, #4, T for C, A for T. 3) "...TACT" should end-of-line-match search string TACTCTACT, because it might be followed by "CTACT". – ikegami Jun 7 '11 at 0:12
@Brian : 1.) I showed 4 different types of main strings for example purpose. 2.) I am allowing for n mismatches. In this case n = 1,2 etc. 3.) the search string could be partially contained in the main string and we want to match that partial case also. Thanks for your questions – Abhi Jun 7 '11 at 1:58
@ikegami : By longest I mean the literally the "longest" and best possible match ( least mismatches). In way this could be misleading and thanks for asking. So longest might not be the right word. What I meant was if the substring is partially contained at the end of main string I would like to pick that case and not ingore it. I hope this makes it a bit more clearer. – Abhi Jun 7 '11 at 2:00
show 2 more comments

2 Answers

up vote 2 down vote accepted

I think you can't do much better than the following for algorithm.

use strict;
use warnings;
use feature qw( say );

sub match {
   my ($s, $t, $max_x) = @_;

   my $m = my @s = unpack('(a)*', $s);
   my $n = my @t = unpack('(a)*', $t);

   push @s, ('?')x($n-1);

   my $best_x = $max_x + 1;
   my $best_i = 0;

   OUTER:
   for my $i (0..$m-1) {
      my $x = 0;

      for my $j (0..$n-1) {
         ++$x if $s[$i+$j] ne $t[$j];
         next OUTER if $x >= $best_x;
      }

      $best_x = $x;
      $best_i = $i;

      last if !$best_x;
   }   

   if ($best_x > $max_x) {
      return undef;
   } else {
      return substr($s, $best_i, $n);
   }
}

say match('AGACGTACTACTTTACAAGATGCA*TACTCTAC*', 'TACTCTACT', 2);
share|improve this answer
you code works absolutely fine. Just wanted to get some idea if the number of sequences that I am checking in a certain amount time sounds feasible or is there a way to scale it up. I am searching for a 36 alphabets substring (with upto 5 mismatches) in 90 million 100 alphabets long search sequences. It is taking me about 13 hours to do this search. Does this sounds like normal based on your experience. I haven't time/memory profiled my code. Thanks! – Abhi Jun 9 '11 at 18:32
@Abhi, I'm no expert in algorithms, but I took every shortcut I could think of. You could make it an order or two faster by implementing it in C. – ikegami Jun 9 '11 at 19:19
May someone explain what's going on in this code? – Mariya Dec 9 '11 at 20:25
1  
@Mariya, It's based on a "dynamic programming" solution to the Longest Common Substring problem. See an explanation of what it's based on here. – ikegami Dec 9 '11 at 21:41

I'm not certain that this is what you're after but BioPerl has an approximate-grep tool called Bio::Grep::Backend::Agrep:

Bio::Grep::Backend::Agrep searches for a query with agrep

And agrep is "approximate grep". AFAIK, this builds a database and then uses that database to make your searches faster so this sounds like what you're after.

Looks like you're working with DNA sequences so you probably have BioPerl already installed.

You could also try using String::Approx directly:

Perl extension for approximate matching (fuzzy matching)

I suspect that Bio::Grep::Backend::Agrep will be faster and a better match for your task though.

share|improve this answer
I will try this and let you guys know it that works and is efficient. – Abhi Jun 7 '11 at 2:01

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.