Matching different patterns to a string

Question

(This is sort of a follow up question to one I asked before)

So I have a DNA string

e.g.

acagatgaaggaggacgcgcccccgccgctgtcctgcgcctcagccatcctatgagacgg

and I have 20 different 3 letter patterns (each combination corresponds to an amino acid) I want to match to the data. My java program looks at 3 letters at a time and tries to match it to one of the patterns. I want to eventually count the number of times each amino acid appears, so when I find a match I need to increment a particular counter. I want to implement this using java regex, so I have:

Pattern A = Pattern.compile("(gct)|(gcc)|(gca)|(gcg)");
Pattern C = Pattern.compile("(tgt) | (tgc)");
Pattern D = Pattern.compile("(gat) | (gac)");

etc.

However, I now realise that you need to make a matcher for EACH pattern and you can't use one matcher to search for ALL patterns; what is the best way for me to achieve what I am trying to do?

Answer 1

Give it a try

String dna = "acagatgaaggaggacgcgcccccgccgctgtcctgcgcctcagccatcctatgagacgg";

Pattern p = Pattern.compile("(gct)|(gcc)|(gca)|(gcg)");
Matcher m = p.matcher(dna);

int count = 0;
while(m.find()) {
  count ++;
}

Answer 2

I wouldn't use a regex here. You have four letters, hence 4^3 = 64 possible triplets. Just loop over the string, translate every triplet to its number (a -> 0, c -> 1, g -> 2, t -> 3, so gcc -> 2*4^2 + 1*4^1 + 1*4^0 = 37), increment counter[number] and ignore the ones you didn't want at the end. (If you want also the positions, it will probably be worth checking whether the current triplet is one of the wanted before inserting into the appropriate list to save some space.)

Answer 3

Factorize your regex :

(gc[tcag]|(tg|ga)[tc])