Tell me more ×
Stack Overflow is a question and answer site for professional and enthusiast programmers. It's 100% free, no registration required.

I am new in D and would like to parse a biological file of the form

>name1
acgcgcagagatatagctagatcg
aagctctgctcgcgct
>name2
acgggggcttgctagctcgatagatcga
agctctctttctccttcttcttctagagaga
>name2
gag ggagag

such that I can capture the 'headers' name1,name2,name3 with the corresponding 'sequence' data, the ..acgcg... stuff.

Now i have this.but it will only iterate line by line,

import std.stdio;
import std.stream;
import std.regex;


int main(string[] args){
  auto filename = args[1];
  auto entry_name = regex(r"^>(.*)"); //captures header only
  auto fasta_regex = regex(r"(\>.+\n)([^\>]+\n)"); //captures header and correponding sequence

  try {
    Stream file = new BufferedFile(filename);
    foreach(ulong n, char[] line; file) {
      auto name_capture = match(line,entry_name);
      writeln(name_capture.captures[1]);
    }

    file.close();
  }
  catch (FileException xy){
    writefln("Error reading the file: ");
  }

  catch (Exception xx){
    writefln("Exception occured: " ~ xx.toString());
  }
  return 0;
}

I would like to know a nice way of extracting the header and the sequence data such that I can create an associative array where each item corresponds to an entry in the file

[name1:acgcgcagagatatagctagatcgaagctctgctcgcgct,name2:acgggggcttgctagctcgatagatcgaagctctctttctccttcttcttctagagaga,.....]
share|improve this question
1  
D seems to be popular among bioinformaticians :) – Trass3r Jan 25 '12 at 15:44

2 Answers

up vote 8 down vote accepted

the header is on it's own line right? so why not check for it and use an appender to allocate for the value

auto current = std.array.appender!(char[]);
string name;
foreach(ulong n, char[] line; file) {
      auto entry = match(line,entry_name);
      if(entry){//we are in a header line

          if(name){//write what was caught 
              map[name]=current.data.dup;//dup because .current.data is reused
          }
          name = entry.hit.idup;
          current.clear();
      }else{
          current.put(line);
      }
}
map[name]=current.data.dup;//remember last capture

map is where you'll store the values (a string[string] will do)

share|improve this answer
many thanks! the header is on its own line. I dont understand where c.hit comes from :) Also why should we allocate entry_name as a match object?(it is supposed to a regex). and finally what is the type for map[name] ? Sorry am a n00b on this at the moment. – eastafri Jan 24 '12 at 21:31
Getting some compile errors(dmd2): expression entry_name of type Regex!(char) does not have a boolean value read_file.d(37): Error: undefined identifier map, did you mean function main? read_file.d(39): Error: cannot implicitly convert expression (c.hit()) of type char[] to string read_file.d(42): Error: no property 'append' for type 'Appender!(char[])' read_file.d(45): Error: undefined identifier map, did you mean function main? read_file.d(49): Error: undefined identifier FileExceptio – eastafri Jan 24 '12 at 21:33
@eastafri made an edit to fix some of those errors – ratchet freak Jan 24 '12 at 21:46
many thanks! Have realised I need to cast(string) current.data.dup to convert it to type string i.e after declaring map as an associative array; string[string] map – eastafri Jan 25 '12 at 5:20
2  
@eastafri You don't dup a string and then cast it to string to get a string. You idup it. dup returns a mutable copy of the array that it's called on. idup returns an immutable copy of the array that it's called on. – Jonathan M Davis Jan 25 '12 at 8:16
show 1 more comment

Here is my solution without regular expressions (I do not believe for such simple input we need regexp):

import std.stdio;
import std.stream;

int main(string[] args) {
  int ret = 0;
  string fileName = args[1];
  string header;
  char[] sequence;
  string[string] content;
  try {  
    auto file = new BufferedFile(fileName);
    foreach(ulong lineNumber, char[] line; file) {
      if (line[0] == '>') {       
        if (header.length > 0) {
          content[header] = sequence.idup;
          sequence.length = 0;
        } // if
        // we have a new header, and new sequence will start after it
        header = line[1..$].idup;
        content[header] = "";
      } else {
          sequence ~= line;
      } // else
    } // foreach
    content[header] = sequence.idup;
    file.close();
  }
  catch (OpenException oe){
    writefln("Error opening file: " ~ oe.toString());
  }
  catch (Exception e){
    writefln("Exception: " ~ e.toString());
  }
  writeln(content);
  return ret;
} // main() function

/+ -------------------------- BEGIN OUTPUT ------------------------------- +
["name3":"gag ggagag", "name1":"acgcgcagagatatagctagatcgaagctctgctcgcgct", "name2":"acgggggcttgctagctcgatagatcgaagctctctttctccttcttcttctagagaga"]
 + -------------------------- END OUTPUT --------------------------------- +/
share|improve this answer
oh nice idea! thanks! – eastafri Jan 25 '12 at 12:08

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Not the answer you're looking for? Browse other questions tagged or ask your own question.