Hello, sorry for the properly stupid question, but I am quite a newbie. I have loads of files which look like this: DET01-ABC-5_50-001.dat ... DET01-ABC-5_50-0025.dat and I wa …

i have some part of text with html tags , for example <b>something</b> i select some part of text for example "some". with getSelection().getRangeAt(0); i get po …

Hi all. I have a file. >Sequence 1.1.1 ATGCGCGCGATAAGGCGCTA ATATTATAGCGCGCGCGCGGATATATATATATATATATATT >Sequence 1.2.2 ATATGCGCGCGCGCGCGGCG ACCCCGCGCGCGCGCGGCGCGATA …

Hi all. In the below file I have 3 occurrences of '.1'. I want to eliminate the last one and write the rest of file to a new file. Kindly suggest some way to do it in PYTHON and th …

I want to show a message box when users trying to do any major operations in my web part. If user choince [Yes], then continue to do sometiing ...[No] for nothing. How can i imple …

Need to convert a web part to a field control on a Sharepoint page. Part of the problem is to migrate all the content on existing pages that use the web part to the corresponding f …

In this question I asked, how to produce rules under sections. The answer provided using sectsty does what I wish, but triggers a problem: If I use the package sectsty the \part-co …

How to remove a blank page that gets added automatically after \part{} or \chapter{} in a book document class? I need to add some short text describing the \part. Adding some text …

If you include the default wiki web part on a page it just shows the names of the articles. I'm looking for a way to actually embed the nicely formated wiki data inside a web part. …

Can you embed one SharePoint web part into another? For example, a client wants a document library but also an ability to write an executive summary about that document using the r …

I am attempting to manage an ajax connection by calling a button onclick method on a separate web part in order to force the partial postback on the consumer. Web part A (Provid …