Hi Everyone , I have written a small program to replace a set of characters , but i also want two or more replace command in a single program . Apart from it i also want to add an bracket after …

In Python 3.x, a string consists of items of Unicode ordinal. (See the quotation from the language reference below.) What is the internal representation of Unicode string? Is it UTF-16? The items …

I'm getting a UnicodeEncodeError: 'ascii' codec can't encode character u'\xa3' in position 34: ordinal not in range(128) on a string stored in 'a.desc' below as it contains the '£' character. …

What is the simplest way to convert a string of keyword=values to a dictionary, for example the following string: name="John Smith", age=34, height=173.2, location="US", avatar=":,=)" to the …

This is a question: "Where is the car?" This is NOT a question: "Check this out: http://domain.com/?q=test" How do I write a function to analyze a string so that we know for sure it is a …

Is there a python class equivalent to ruby's StringScanner class? I Could hack something together, but i don't want to reinvent the wheel if this already exists.

Hi Alls, I'd like to remove one char from a string like this: string = "ASDFVGHFJHRSFDZFDJKUYTRDSEADFDHDS" print len(string) (33) So i would like to remove one random char in this string, and …

Hi all! I am feeling difficult to convert a float to string in the following manner: 20.02 --> 20.02 20.016 --> 20.02 20.0 --> 20 Seems "%g" format is the best for that, but I am …

If it is environment-independent, what is the theoretical maximum number of characters in a python string? Also if it differs with version number I'd like to know it for python 2.5.2

So I got a DNA sequence. ACCAGAGCGGCACAGCAGCGACATCAGCACTAGCACTAGCATCAGCATCAGCATCAGC CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT …

I have huge list (200000) of strings (multi word). I want to group these strings based on comman array of word match among these strings. I cant think of a low computation time algorithm for this …

I have string ling like this: 'Toy Stroy..(II) (1995)' I want to split the line to two parts like this: ['Toy Story..(II)','1995'] How can I do it? thanks

This is the first time I've came across this. Just printed a list and each element seems to have a u in front of it i.e. [u'hello', u'hi', u'hey'] What does it mean and why would a list …

In Python, I have just read a line form a text file and I'd like to know how to code to ignore comments with a hash # at the beginning of the line. I think it should be something like this: for …

Hi, I'm currently having trouble creating an image from a binary string of data in my Python program. I receive the binary data via a socket but when I try the methods I read about on here like …